Compare and contrast DNA replication and Transcription.
What are the functions of RNA polymerase I, Il and IlI?
In eukaryotes transcription, what would happen if: a. RNA polymerase III is disabled b. RNA polymerase Il is disabled c. RNA polymerase I is disabled d. snRNPs are disabled
What signal terminates a protein chain?
Explain the role of release factors in transcription termination.
Below is a representation of a gene that encodes a protein. Which transcribed gene parts are included in the mRNA that interacts with the ribosome?A. 2, 3, 5, 6B. 3, 5, 6C. 3, 5D. 1, 2, 3, 5, 6E. 2, 3, 5
Compare and contrast RNA ploymerase in prokaryotes with DNA polymerase.
If the following DNA is read in transcription, which of the following will be the start of the mRNA strand (all answers are 5' to 3')?Template: 3' - AATTGGTTTGGTTCCTGTA - 5'Coding: 5' - TTAACCAAACCAAGGACAT - 3'A. UUAACCAAACCAAGGACAUB. AAUUGGUUUGGUUCCUGUAC. AUGUCCUUGGUUUGGUUAAD. UACAGGAACCAAACCAAUU
Briefly describe the structure of eukaryotic chromatin. Cite two mechanisms by which that structure can be modified (from euchromatin to heterochromatin). Explain how these modifications can affect transcription.
A template DNA strand contains the sequence 5'- ATG CTG AC -3'. This strand is transcribed __________.A. in a direction which depends on whether the cell is prokaryotic or eukaryotic.B. in a direction which depends on the transcription unit. C. from left to right.D. from right to left.
Within a certain transcription unit, part of the template DNA strand has the following base sequence: 3' - GTC CCA ATT TAT - 5'. What would be the corresponding mRNA sequence?A. 5' - UAU UUA ACC CUG - 3'B. 5' - CAG GGU UAA UAU - 3'C. 5' - CAG GGT TAA TAT - 3'D. 3' - UAU AAU UGG GAC - 5'E. 3' - GUC CCA AUU UAU - 5'F. None of the above
Consider the transcription bubbles shown below. If the gene is located to the left of the bubble, will the top or botom strand of DNA serve as the template?A. Lower strandB. Insufficient information to answer the questionC. Upper strand
Which mRNA sequence does not play a role in intron splicing?A. an adenine nucleotide 18-40 nucleotides upstream of the 3' splice siteB. the 5' splice siteC. the Shine-Dalgarno sequenceD. the 3' splice siteE. the branch point
In eukaryotic cells, promoter consensus sequences are recognized by accessory proteins that recruit a specific RNA polymerase. Which of the following types of accessory proteins serve this purpose?A. Single strand-binding proteinsB. enhancerC. general transcription factorsD. transcription activatorsE. transcription repressors
Why is a cap added to mRNA, but not to tRNA or rRNA?A. RNA polymerase II transcribes mRNA, whereas RNA polymerase I transcribes rRNA, and RNA polymerase III transcribes tRNA. The domain that assists other enzymes in adding the cap is found in RNA polymerase II only.B. The double stranded regions on tRNA and mRNA result in complex folding and a three-dimensional shape of each molecule. The structure of tRNA and rRNA makes the 5’ end of the molecule inaccessible to the enzymes that add the cap.C. Transcription and processing of mRNA occur in the nucleus, where cap binding proteins are found. These proteins, which add and modify the cap, are not found in the cytoplasm, where tRNA and rRNA are transcribed and processed.D. Only mRNA contains introns. The capping process requires RNA to interact with the proteins that remove introns. Therefore, the capping and splicing processes occur at the same time.
The extreme 3' end of a prokaryotic mRNA is given below. What features of this RNA indicate that the sequence includes a transcription termination site? Check all features that apply.5' ... GAUGGGCGGGGGGGAAAUUAACCCCCCCGCCCUUUUUUU 3'A. It contains a stop codonB. It is a complete ORFC. It has an array of U nucleotides near its 3' endD. It has the potential to form a stem-loop structure
Which of the following is NOT correct regarding mRNA?A. All mRNAs have 5' untranslated regionsB. All mRNAs contain a promoter 5' (upstream) of the transcription start siteC. Bacterial transcription is terminated, in part, by the formation of a stem-loop (or hairpin), 2º structure in the mRNAD. All mRNAs encode proteins
Describe four differences between Prokaryotic and Eukaryotic transcription.
What is a promoter? Where on the transcription is it located? upstream or downstream?
Which of the following is correct about the synthesis of RNA during transcription?A. It proceeds in a 5' to 3' direction, antiparallel to the sense (non-template) strand.B. It proceeds in a 5' to 3' direction, antiparallel to the antisense (template) strand.
Describe the difference between the 5' and 3' ends of a single-stranded nucleic acid and describe the ‘antiparallel' nature of double-stranded DNA.
Which enzyme carries out transcription? How does this enzyme know where to start transcript and where to stop?
Which statement is most consistent with the one gene, one enzyme hypothesis originally proposed by Beadle and Tatum?A. Genes and enzymes are important.B. Every gene encodes a separate enzyme.C. A gene can only make one enzyme in a cell cycle.D. Each gene makes one enzyme but not one protein.E. Every enzyme makes one gene.
Describe the epigenetic mechanisms that affect transcription in eukaryotes.
Which is NOT a function of general transcription factors?A. recruitment and binding of RNA polymerase to promotersB. melting of the DNA helix to expose templateC. escape of the polymerase from the promoterD. termination of transcription
In the diagram below, two new nucleic acid strands are being synthesized.Extend each of the two fragments by adding two nucleotides (two for each fragment) at the appropriate locations - meaning where the polymerase would add them.Does this diagram represent transcription or replication? Provide appropriate evidence and reasoning to support your claim.
What is the function of a start codon? A stop codon?
Signal transduction pathways can have a direct effect on transcription factors. What is the function of transcription factors?
Which of the following are different between prokaryotic and eukaryotic transcription? Select all that apply.A. The area within the cell in which transcription occurs.B. The processing of RNA.C. The promoter sequences used.D. The polymerase used to create RNA.E. The direction of transcription along the DNA molecule.
Which of the following is the correct transcript of mRNA for the following DNA template?DNA template: 3' - ATGAAGCCGAGTCAT - 5'A. 3' - AUGACUCGGCUUCAU - 5'B. 3' - UACUUCGGCUCAGUA - 5'C. 3' - ATGACTCGGCTTCAT - 5'D. 3' - TACTTCGGCTCAGTA - 5'
Which of the following is the correct transcript of mRNA for the following DNA template? (Note: this is not an entire sequence, it is just a small portion)DNA Template: 3'-ATGAAGCCGAGTCAT-5'A. 3'-TACTTCGGCTCAGTA-5'B. 3'-AUGACUCGGCUUCAU-5'C. 3'-UACUUCGGCUCAGUA-5'D. 3'-ATGACTCGGCTTCAT-5'
During transcription of DNA to RNA:A. the RNA polymerase moves along the DNA in the 5' to the 3' direction.B. the 3' end of the RNA molecule is produced first. C. an RNA polymerase must first bind to a promoter sequence.D. transcription is always initiated at a "start codon"
What are the roles of transcription factors in eukaryotic transcription?
Transcription is sometimes described as a process in which RNA is "copied" from the template strand of DNA. This statement is potentially misleading _____.A. because the nucleotides in RNA contain ribose and so cannot be an exact copy of DNA.B. because RNA molecules contain uracil instead of thymine.C. because the RNA transcript has a complementary sequence of bases to the template strand.D. because all of the reasons listed in the other choices are correct.E. because the RNA transcript and the DNA template strand are antiparallel.
During which stage of eukaryotic transcription do the following processes take place?1. RNA polymerase II binds to the promoter2. The RNA transcript is released3. The RNA transcript extendedA. 1-termination; 2-initiation; 3-elongationB. 1-initiation; 2-elongation; 3-terminationC. 1-elongation; 2-termination; 3- initiationD. 1-initiation; 2-termination; 3-elongationE. 1-termination; 2-elongation; 3-initiation
What would be the sequence of the RNA produced from the following DNA segment, with the arrow indicating the start and direction of transcription? Write the sequence of the RNA with the 5' end at the left and assume transcription continues to the end of the sequence shown. →5' - CCCGGTGAATGCTGAATCATATCTTA - 3'3' - GGGCCACTTACGACTTAGTATAGAAT - 5'
What would be the sequence of the RNA produced from teh following DNA segment, with the arrow indicating the start and direction of transcription? Write the sequence of the RNA with the5' end at the left and assume transcription continues to the end of the sequence shown.5' - CCCGGTGAATGCTGAATCATATCTTA - 3'3' - GGGCCACTTACGACTTAGTATAGAAT - 5' ←
Where does RNA polymerase attach and initiate transcription on the DNA sequence?