Repair Mechanisms and Telomeres

What are telomeres-where it is located?

In the synthesis of DNA ends by telomerase, what is the template strand, the end added, and the type of polymerase?A. Lagging template strand, 5' end, DNA polymeraseB. Lagging template strand, 3' end, DNA polymeraseC. Leading template strand, 5' end, DNA polymeraseD. Leading template strand, 3' end, reverse transcriptaseE. Lagging template strand, 3' end, reverse transcriptase

Which of the following enzymes in base pair excision repair is NOT required to repair depurinated nucleotides?A. DNA polymeraseB. LigaseC. GlycosylaseD. Endonuclease

Which DNA repair mechanism do you expect to fix errors that escaped repair by proofreading?A. the mismatch repair systemB. base-excision repairC. nucleotide-excision repairD. photoreversion

Below is the sequence of DNA at the end of a just replicated chromosome. The origin of replication is represented by the *:*... AAGGCTAAGCAATTGTTCCCTTCCCTTCCCTTCC - 5'*... TTCCGATTCGTTAACAAGGGAAGGGAAGGGAAGG - 3'*... AAGGCTAAGCAATTGTTCCCTTC - 5'*... TTCCGATTCGTTAACAAGGGAAGGGAAGGGAAGG - 3'a. Label the sequences that were the leading and lagging strands.b. Which of the following could be a telomerase RNA:A. 5' - AAGGGAAG - 3'B. 5' - TTCCCTTC - 3'C. 5'- UUGGGUUG - 3'D. 5' - UUCCCUUC - 3'

Homologous recombination may result in gene conversion when used to fix double-stranded DNA breaks because:A. sister chromatids are always identical.B. the Holliday junction may migrate, resulting in loss of genetic material.C. strand invasion may introduce new genes onto the damaged chromosome.D. homologous chromosomes may carry different alleles of the same gene.

What is the most significant role of homologous recombination in eukaryotes that is not found in prokaryotes?A. exchange of genetic information between homologous chromosomesB. generation of heteroduplex DNAC. gene conversionD. DNA repair

Telomeres are sequences added to the ends of chromosome through the activity of telomerase, which contains reverse transcriptase (RT). Why is RT a DNA polymerase? What template does it use? What is the primer?

Telomerase lengthens the ends of chromosomes. Telomerase is a(n) _____ polymerase that is comprised of a _____ primer.A. DNA; RNAB. RNA; DNAC. DNA; DNAD. RNA; RNA

What is the composition of a telomerase enzyme

Which activities, listed as numbers 1 to 4, does E. coli DNA polymerase I have?1. 5' to 3' polymerase2. 3' to 5' poolymerase3. 5' to 3' exonuclease4. 3' to 5' exonucleaseA. 1 and 2B. 1, 2, and 4C. 1, 2, and 3D. 1, 3, and 4 E. 1 and 4

Consider the following DNA sequence:5' - TAAGCTGCTG - 3'3' - ATTCGACGAC - 5'A. Deamination occurs at the C at position 7 (bottom strand). Show the double-stranded DNA daughter sequences following a round of DNA synthesis.B. What would happen if the original sequence were irradiated with UV?C. What repair pathway would be used to repair the mutation in (A)?D. What repair pathway would be used to repair the UV products in (B)?