Biology Practice Problems Nucleic Acids Practice Problems Solution: What is the reverse complement of the following DN...

Solution: What is the reverse complement of the following DNA sequence? Give your answer in the 5' to 3' direction.5' - TAAACAAAGAAGTACAACAA - 3'

Problem

What is the reverse complement of the following DNA sequence? Give your answer in the 5' to 3' direction.

5' - TAAACAAAGAAGTACAACAA - 3'

Solution

A double stranded DNA has its two complementary strands going in antiparallel direction: one goes from 5' to 3' as the other goes from 3' to 5'. This is the additional essential information aside from base complementarity.

Solution BlurView Complete Written Solution