Problem: What is the reverse complement of the following DNA sequence? Give your answer in the 5' to 3' direction.5' - TAAACAAAGAAGTACAACAA - 3'

FREE Expert Solution

A double stranded DNA has its two complementary strands going in antiparallel direction: one goes from 5' to 3' as the other goes from 3' to 5'. This is the additional essential information aside from base complementarity.

View Complete Written Solution
Problem Details

What is the reverse complement of the following DNA sequence? Give your answer in the 5' to 3' direction.

5' - TAAACAAAGAAGTACAACAA - 3'

Frequently Asked Questions

What scientific concept do you need to know in order to solve this problem?

Our tutors have indicated that to solve this problem you will need to apply the Nucleic Acids concept. You can view video lessons to learn Nucleic Acids. Or if you need more Nucleic Acids practice, you can also practice Nucleic Acids practice problems.